Exercise 1

Ensure you are in the correct directory before carrying out the below commands

cd ~/Linux/
  1. Change the name of the subdirectory 4_exercises_aaaa within your Linux to 4_exercises
mv four_exercises 4_exercises
  1. Make a backup of the 4_exercises directory
cp -r 4_exercises 4_exercises_backup
  1. List the contents of the 4_exercises directory
ls 4_exercises
  1. Within the directory 4_exercises
cd 4_exercises

Print the working directory

pwd
  1. Print out to screen the phrase ‘the echo command allows me to print phrases to screen’
echo “the echo command allows me to print phrases to screen”
  1. Copy the file copy_this_file.txt to the directory to_me
cp copy_this_file.txt to_me
  1. Rename the directory to_me to you
mv to_me you
  1. Delete the initial copy_this_file.txt file
rm copy_this_file.txt

Exercise 2

Ensure you are in the correct directory before carrying out the below commands

cd ~/Linux/6_final_exercise
  1. See what files are in the directory
ls
  1. Rename the file 3-P£_CACTTCGA_L001_R1_001.fastq to 3-P3_CACTTCGA_L001_R1_001.fastq
mv 3-P£_CACTTCGA_L001_R1_001.fastq \
3-P3_CACTTCGA_L001_R1_001.fastq
  1. Make a backup of the files in a directory called backup
mkdir backup
cp 1-P1_ATGCCTGG_L001_R1_001.fastq backup/
cp 1-P1_ATGCCTGG_L001_R2_001.fastq backup/
cp 2-P2_AAGGACAC_L001_R1_001.fastq backup/
cp 2-P2_AAGGACAC_L001_R2_001.fastq backup/
cp 3-P3_CACTTCGA_L001_R1_001.fastq backup/
cp 3-P3_CACTTCGA_L001_R2_001.fastq backup/
cp 4-E1_ATTGGCTC_L001_R1_001.fastq backup/
cp 4-E1_ATTGGCTC_L001_R2_001.fastq backup/
cp metadata.txt backup/

This can be done a lot quicker with the use of wildcard characters (Covered in Advanced Linux section)

mkdir backup
cp *fastq backup
cp *txt backup
  1. How many reads are in the samples?

The below command will give the number of lines in the files, this number can then be divided by 4 (mentally or using a calculator). These values will be the same for the R2 files as they are for the matching R1 file.

wc -l 1-P1_ATGCCTGG_L001_R1_001.fastq \
2-P2_AAGGACAC_L001_R1_001.fastq \
3-P3_CACTTCGA_L001_R1_001.fastq

An advanced method using regular expressions, wildcard characters and grep

grep -c "^@[0-9]*_" *R1*.fastq
  1. Remove the fastq files with no data

Check which files have no data

wc \
1-P1_ATGCCTGG_L001_R1_001.fastq 1-P1_ATGCCTGG_L001_R2_001.fastq \
2-P2_AAGGACAC_L001_R1_001.fastq 2-P2_AAGGACAC_L001_R2_001.fastq \
3-P3_CACTTCGA_L001_R1_001.fastq 3-P3_CACTTCGA_L001_R2_001.fastq \
4-E1_ATTGGCTC_L001_R1_001.fastq 4-E1_ATTGGCTC_L001_R2_001.fastq

Remove empty files

rm \
4-E1_ATTGGCTC_L001_R1_001.fastq 4-E1_ATTGGCTC_L001_R2_001.fastq
  1. Update the backup files with the previous change
rm backup/4-E1_ATTGGCTC_L001_R1_001.fastq \
backup/4-E1_ATTGGCTC_L001_R2_001.fastq
  1. Check if the 1st read names match in the paired files
head -n 1 \
1-P1_ATGCCTGG_L001_R1_001.fastq 1-P1_ATGCCTGG_L001_R2_001.fastq \
2-P2_AAGGACAC_L001_R1_001.fastq 2-P2_AAGGACAC_L001_R2_001.fastq \
3-P3_CACTTCGA_L001_R1_001.fastq 3-P3_CACTTCGA_L001_R2_001.fastq
  1. Check if the last read names match in the paired files
tail -n 4 \
1-P1_ATGCCTGG_L001_R1_001.fastq 1-P1_ATGCCTGG_L001_R2_001.fastq \
2-P2_AAGGACAC_L001_R1_001.fastq 2-P2_AAGGACAC_L001_R2_001.fastq \
3-P3_CACTTCGA_L001_R1_001.fastq 3-P3_CACTTCGA_L001_R2_001.fastq
  1. In file 1-P1_ATGCCTGG_L001_R1_001.fastq look for sequence headers with the term ‘psychrobacter’
grep “psychrobacter” 1-P1_ATGCCTGG_L001_R1_001.fastq
  1. In the sample 1-P1 remove any fastq entries where the term ‘psychrobacter’ appears in the fastq header. Do this for the R1 and R2 file.

Using nano navigate to the psychrobacter sequences. Then use "Ctrl+K" to cut the lines followed by "Ctrl+W" and "Ctrl+X" to save and exit.

  1. Print to screen the fastq header, sequence and quality data for the 25th sequence in sample 2-P2 for both the R1 and R2 file. Do this with one command.

@24_ecoli is grepped as the first sequence is @0_ecoli

grep -A 3 "@24_ecoli" 2-P2_AAGGACAC_L001_R1_001.fastq
grep -A 3 "@24_ecoli" 2-P2_AAGGACAC_L001_R2_001.fastq

Advanced exercise

  1. Copy the directory ~/Linux/advanced_practice to ~/Linux/advanced_practice_exercise
cp -r ~/Linux/advanced_practice ~/Linux/advanced_practice_exercise
  1. Move into ~/Linux/advanced_practice_exercise
cd ~/Linux/advanced_practice_exercise
  1. Make a directory called fastq and one called txt
mkdir fastq txt
  1. With one command move all the fastq files into the directory fastq
mv *.fastq fastq/
  1. With one command move all the txt files, excluding metadata.txt and samples.txt, into the directory txt.
mv sample_*txt txt/
  1. Create a file in the fastq directory called patient_1_corrected.fastq and put all the corrected fastq data for patient_1 into the file.
cat fastq/sample_[1-2]_*corrected.fastq > \
fastq/patient_1_corrected.fastq
  1. Append the metadata line for sample_1_AAAA from metadata.txt to the bottom of the file sample_1_AAA.txt in the txt directory.
cat metadata.txt | grep "sample_1_AAAA" >> txt/sample_1_AAAA.txt
  1. For all the corrected fastq files find the sequences that start with a stop codon in the forward orientation (i.e. TAG, TAA or TGA). Print out to screen the sample name and sequence info separated by a “:” only (i.e. sample_10_AAGT:TAAGAGAACAATGAACAGATATTAATAATTTTGCCGCTTTTCTGCGGGAT)
grep "^TA[AG]\|^TGA" fastq/*corrected.fastq | \
sed "s/.*sample/sample/" | sed "s/_corrected.fastq//"
  1. Count the number of Gs and Cs within the sequences of file sample_16_AACC.fastq
cat fastq/sample_16_AACC.fastq | grep -B 1 "^+$" | \
grep -v "+\|--" | sed "s/A\|T//g" | wc -c
  1. Get the fastq headers of sequences with homopolymers made of As with a length of 5 or greater for the uncorrected fastq files for samples 8-13 with one command. Then in the same command make the final output of each line in the format of “Sample_13: Sequence 12”
cat fastq/*[3-5]*[AGCT].fastq | grep -B 2 "^+$" | \
grep -B 1 "AAAAA" | grep "^@" | sed "s/^@s/S/" | \
sed "s/_[AGCT]*_/: Sequence /" | sed "s/ 1:$//"